TNF differentially regulates ganglioside biosynthesis and ... - PLOS

Apr 26, 2018 - Abbreviations: BSA, bovine serum albumin; CSC, ...... 1780: 421–433. https://doi.org/10.1016/j.bbagen.2007.10.008 PMID: 17991443. 3...

0 downloads 0 Views 9MB Size

Recommend Documents

Jul 27, 1983 - apparatus by blocking sugar nucleotide transport across the ... Gerhard-Domagk-Strasse 1, 5300 Bonn 1, Federal Republic of Germany.

Jan 25, 2017 - and Disease, Guangzhou, 510080 China. Clinical studies ... (Mutso et al., 2012), and knee osteoarthritis (Mao et al., 2016), suggesting that ...

May 22, 2013 - CACCGCCGCACTCT -39; urotensin 2 (UTS2) were (forward) 59-. AAGTTTCAGGATTTCTCTGGACAAGATCC -39 and (re- verse) 59- ...

Feb 15, 2013 - the spinal cord, the effect of GABA is less influential on motor neuron development compared to that of glycine. Citation: ... between embryonic day [E] 13 and birth [1,3,4,5,6,7]. The ... C shows serial sections of the lumbar lateral

We also found that the sugar signal transduction pathway may overlap the glycolytic pathway for ... Biomedical Research Foundation of the Republic of China.

Koji Eto,1 Hidekazu Nishikii,1 Takunori Ogaeri,1 Shiro Suetsugu,2,3 Akihide ... Environmental Biology, Hokkaido University Graduate School of Medicine, Sapporo, Japan ...... 8639 Japan; e-mail: [email protected], [email protected]

Nov 3, 2015 - knockdown increased the rate of re-endothelialization. ... metal stents, which is likely due to the failure of the treated artery to re-endothelialize.

a Present address: Departments of Physical Therapy, and Anatomy and Cell. Biology .... (DHT, purchased from Sigma Chemical. Company as .... 1976; McQuarrie, 1978; Bisby, 1979, 1985; McQuarrie and. Lasek, 1989) ..... serum-free medium.

Candesartan Differentially Regulates Epithelial Sodium Channel in Cortex. Versus Medulla of Streptozotocin-Induced Diabetic Rats. Janet D. Klein. 1.

onstrated enhanced OPG expression in areas adjacent to arterial calcification in patients with atherosclerosis or Mönckeberg's sclerosis (8, 9). Furthermore ...

Dec 5, 2001 - Cell and Developmental Biology, Emory University, Atlanta, Georgia 30322. Received 10 October .... tion methods and cleaned of excess fat and connective tissue. In some ... muscle was embedded in tissue freezing medium (Triangle ... Ass

matrix protein gene expression in AF cells of the interver- tebral disc. Unlike AF .... from cells of the AF and NP to test for a differential effect of media generated ...

Apr 17, 2017 - 2+ channel differentially regulates. Clathrin-mediated and activity-dependent bulk endocytosis. Chi-Kuang Yao1,2,3*, Yu-Tzu Liu1, I-Chi Lee1, ...

Dec 12, 2013 - Arachidonyl trifluoromethyl ketone (AACOCF3,. ATK) was from Enzo Life Sciences (Farmingdale, NY, USA). PBS was from Oxoid (Basingstoke, ...

Apr 10, 2012 - of TLR ligands (i.e. free LPS), by upregulation of circulating LBP. [18] or lipoproteins [19]. ..... Tomic V, Russwurm S, Moller E, Claus RA, Blaess M, et al. (2005). Transcriptomic and .... 6965–6975. 31. Williams L, Bradley L, ...

(DRG) neurons are involved in nerve injury-induced hyperal- gesia. Proinflammatory cytokines such as the tumor necrosis factor-α (TNF-α) which are released ...

+ 10% FCS and treated with sodium butyrate ..... versed by placing the cells back in 10% FCS prior to sodium butyrate ..... Moog, F. Developmental adaptations.

Dec 21, 2016 - VDR-mediated Atg16L1 mRNA expression, membranous. Atg16L1 protein ..... sepsis and ventilator-associated pneumonia[24] provides.

Jun 12, 2009 - Financial support: National Institutes of Health (grant U19 AI57319). The contents of ... infected with DENV2 or mock control (C636 culture super- natant). .... Suppression of tumor necrosis factor (TNF)–a–driven endothelium hyperp

Imelyn Fernandez and Joanne Mackow for technical assistance. REFERENCES ... Reinhard, C., Shamoon, B., Shyamala, V., and Williams, L. T. (1997) EMBO J.

May 7, 2008 - tially regulates chondrocyte spreading on fibronectin and bone sialo- protein. ... sion and spreading dynamics on fibronectin (FN) and bone sialopro- tein (BSP). ...... by Canadian Institute of Health Research grants to F. Beier and H.

Aug 17, 2006 - Src, despite no change in FAK-397 and an inhibition of FAK-576 phosphorylation. DCA concomitantly and significantly increased as- sociation of tyrosine phosphatase ShP2 with FAK. Incubation of immunoprecipitated FAK, in vitro, with glu

Sep 7, 2016 - absence or presence of androgens (10 nM DHT or 1 nM R1881). Androgen treatment had negligible effects on the proliferation of empty.

net, William F. Jackson, and Nancy J. Rusch. Intracellu- lar acidosis differentially regulates KV channels in coronary and pulmonary vascular smooth muscle.